XB-FEAT-5995339: Difference between revisions
Jump to navigation
Jump to search
imported>Kevin No edit summary |
imported>Kevin No edit summary |
||
| Line 2: | Line 2: | ||
This is the community wiki page for the gene ''gdf11.2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''gdf11.2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
==Available Reagents== | |||
===Morpholino Oligonucleotides=== | |||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
ACAGAGGGCACAGCTGAGACAGCAT (Translation Blocking) <br /> | ACAGAGGGCACAGCTGAGACAGCAT (Translation Blocking) <br /> | ||
Latest revision as of 13:41, 12 November 2012
gdf11.2
This is the community wiki page for the gene gdf11.2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
ACAGAGGGCACAGCTGAGACAGCAT (Translation Blocking)
GAAAAAACACTTACTTTCCTGTGCC (Splice-Donor Blocking)
which were used in [1]