XB-FEAT-853107: Difference between revisions
Jump to navigation
Jump to search
imported>Xenbase gene generator No edit summary |
imported>Kevin No edit summary |
||
Line 1: | Line 1: | ||
=en2= | =en2= | ||
This is the community wiki page for the gene ''en2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | This is the community wiki page for the gene ''en2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
Morpholinos have been designed for this gene with a sequence | |||
CATTCTCTTCCATGCTGTTCCCC | |||
which was used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41202] |
Latest revision as of 12:33, 12 November 2012
en2
This is the community wiki page for the gene en2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Morpholinos have been designed for this gene with a sequence CATTCTCTTCCATGCTGTTCCCC
which was used in [1]