XB-FEAT-855943: Difference between revisions
imported>Xenbase |
|||
(5 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
= | = h2axl = | ||
This is the community wiki page for the gene '' | This is the community wiki page for the gene ''h2axl'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase | ||
=nomenclature changes= | =nomenclature changes= | ||
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. | On 7/3/2019, this gene was changed from ''h2afx'' to ''h2afxl'' to designate that it is a like gene. | ||
As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for ''Xenopus'' gene is ''h2axl''. | |||
08.23.2019 | |||
Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX | |||
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX | Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX | ||
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone | ||
17JULY2022 | |||
Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!) | |||
''Xenopus'' gene changed from ''h2axl'' back to ''h2ax'' | |||
Note: this page had a few typos with dots (.) in in gene symbols. These have been removed. | |||
a synteny/phylogenetic anaylsis might be needed to see if this Xenopus gene is the true ortholog of the human H2AX | |||
=Available Reagents= | |||
==Morpholino Oligonucleotides== | |||
Morpholinos have been designed for this gene with sequences <br /> | Morpholinos have been designed for this gene with sequences <br /> | ||
Line 25: | Line 31: | ||
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=41767] | ||
This sequence is shared by gene | This sequence is shared by gene ''hist2h2ab'' and may, therefore, be cross-reactive. |
Latest revision as of 14:58, 28 July 2022
h2axl
This is the community wiki page for the gene h2axl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
nomenclature changes
On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene. As Xenopus follows human nomenclature, XB kept the 'like' designation, so new name is H2A.X variant histone-like, and new symbol for Xenopus gene is h2axl. 08.23.2019
Human symbol has changed for gene page ID: 855943 From h2afxl to h2aX
Human symbol has changed for Entrez Gene: 3014. From H2AFX to H2AX
Human name has changed for Entrez Gene: 3014. From H2A histone family member X to H2A.X variant histone
17JULY2022
Human-Like symbol has changed for genepage ID: 855943 From h2axl to H2AX ( the like is gone!)
Xenopus gene changed from h2axl back to h2ax
Note: this page had a few typos with dots (.) in in gene symbols. These have been removed.
a synteny/phylogenetic anaylsis might be needed to see if this Xenopus gene is the true ortholog of the human H2AX
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT
which were used in [1]
This sequence is shared by gene hist2h2ab and may, therefore, be cross-reactive.