XB-FEAT-855943

From XenWiki
Revision as of 12:05, 3 July 2019 by imported>JoshuaFortriede (→‎h2afxl)
Jump to navigation Jump to search

h2afxl

This is the community wiki page for the gene h2afxl please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Nomenclature

On 7/3/2019, this gene was changed from h2afx to h2afxl to designate that it is a like gene.


Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TGACGGCTTTTCCTCTGCCCGACAT

which were used in [1]

This sequence is shared by gene symbol hist2h2ab and may therefore be cross-reactive.