XB-FEAT-919663: Difference between revisions

From XenWiki
Jump to navigation Jump to search
imported>Xenbase gene generator
No edit summary
 
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
=ventx2.1=  
=''ventx2''=  
This is the community wiki page for the gene ''ventx2.1'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
This is the community wiki page for the gene ''ventx2'' please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
 
==Available Reagents==
===Morpholino Oligonucleotides===
Morpholinos have been designed for this gene with sequences <br />
TTCCTGTAGTAGTCCTTGTGTTCAT <br />
 
 
which were used in [http://www.xenbase.org/literature/article.do?method=display&articleId=7052]
 
=nomenclature changes=
 
1MAY2023
 
''Xenopus'' gene symbol was changed from ''ventx2.1'' to ''ventx2''

Latest revision as of 10:46, 1 May 2023

ventx2

This is the community wiki page for the gene ventx2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
TTCCTGTAGTAGTCCTTGTGTTCAT


which were used in [1]

nomenclature changes

1MAY2023

Xenopus gene symbol was changed from ventx2.1 to ventx2