XB-FEAT-920867

From XenWiki
Revision as of 10:35, 13 November 2012 by imported>Kevin
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

ventx1.2

This is the community wiki page for the gene ventx1.2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CAATAGAGAATCCCTGTTGAACCAT

This morpholino is 100% conserved against the homeologue ventx1.1


which were used in [1]