XB-FEAT-493412
(Redirected from Xgap)
arfgap3
This is the community wiki page for the gene arfgap3 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.
nomenclature changes
29OCT202
Human symbol has changed for Entrez Gene: 26286. From ARF GTPase activating protein 3 to arfgap3
Human name has changed for Entrez Gene: 26286. From ADP ribosylation factor GTPase activating protein 3 to ARF GTPase activating protein 3
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CGGTTCCGCCATTCTCCGTCTCTCT
which were used in [1]