XB-FEAT-486360

ruvbl1

This is the community wiki page for the gene ruvbl1 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Available Reagents

Morpholino Oligonucleotides

Morpholinos have been designed for this gene with sequences
CATGAAAATCGAGGAGGTGAAGAGC

which were used in [1]

nomenclature changes

04/22/ 2016

Human name has changed for Entrez Gene: 8607. From RuvB-like AAA ATPase 1 to RuvB like AAA ATPase 1