XB-FEAT-922931
(Redirected from Xtrkb)
ntrk2
This is the community wiki page for the gene ntrk2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Available Reagents
Morpholino Oligonucleotides
Morpholinos have been designed for this gene with sequences
CCACTGGATCCCCCCTAGAATGGAG
which were used in [1]
nomenclature changes
04/22/ 2016
Human name has changed for Entrez Gene: 4915. From neurotrophic tyrosine kinase, receptor, type 2 to neurotrophic receptor tyrosine kinase 2