XB-FEAT-5761258

From XenWiki
Jump to navigation Jump to search

epha2

This is the community wiki page for the gene epha2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase.

gene expression notes

Xenopus epha2 has very interesting gene expression pattern, being in 1 of the hindbrain rhommeres and 1 neural crest stream. but which ones?

Dibner et al (2001)[PubMed ID: 11566848] looked at hindbrain patterning in did a series of double & triple in situs to seperate the rhombomeres and gene specific expression. They showed the epha2, known then as XE10, was expressed in the R4 rhombomere, and the branchial crest, in addition to the posterior mesoderm/tailbud and posterior neural tube.

Brändli and Kitchener (1995) however labeled this as rhombomere R3, and hyoidal crest (see XB-IMG-84569) in their paper specifically looking to identifyEck-related genes expressed in cranial neural crest cells of the second (hyoid) arch." [PubMed ID: 7655077]. they also compared this protein, referred to as G50, to stainging of en2/engrailed (the midbrain-hindbrain boundary marker, and egr2 (krox20), with specific expression in R3 and R5 rhombomeres.


Xenopus laevis protein-tyrosine kinase (G50) mRNA, partial cds; GenBank: U11727.1

FASTA

>U11727.1 Xenopus laevis protein-tyrosine kinase (G50) mRNA, partial cds GCTCGCAACATTCTGGTGAACAGTCAACTGGTGTGCAAAGTGTCTGATTTTGGGCTCTCTCGAGTGCTGG AGGATGACCCCGAGGCTACTTATACAACTAGTGGTGGAAAGATCCCAATCCGTTGGACGGCCCCTGAAGC CATCTCTTACCGGAAGTTCACCTCCGCCAGT

BLAST- 100% identy to epha2.S Entrez Gene: 100191024, and epha2.L Entrez Gene: 394370.


Le Bouffant et al (2025), [PubMed ID: 41307306] in a paper that screened many efn and eph gene family members for pronephric expression, dismissed the epha2.L gene (and others) as 'vascular expression', which it clearly is not. images from this study are used as summary images for this pages, and are curated to and epha2.L.