XB-FEAT-853107

From XenWiki
(Redirected from Eng2)
Jump to navigation Jump to search

en2

This is the community wiki page for the gene en2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase

Morpholinos have been designed for this gene with a sequence CATTCTCTTCCATGCTGTTCCCC


which was used in [1]