XB-FEAT-853107
Jump to navigation
Jump to search
en2
This is the community wiki page for the gene en2 please feel free to add any information that is relevant to this gene that is not already captured elsewhere in Xenbase
Morpholinos have been designed for this gene with a sequence CATTCTCTTCCATGCTGTTCCCC
which was used in [1]